Table 1

Primer sequence, annealing temperatures and fragment length, for PDGFR-α exons

Exon

Primer sequence (5'→3')

Annealing temperature (°C)

Fragment length (base pairs)


12

F, TCCAGTCACTGTGCTGCTTC; R, GCAAGGGAAAAGGGAGTCTT

58

260

18

F, ACCATGGATCAGCCAGTCTT; R, TGAAGGAGGATGAGCCTGACC

60

251


F, forward primer; PDGFR-α, platelet-derived growth factor receptor α; R, reverse primer.

Carvalho et al. Breast Cancer Research 2005 7:R788-R795   doi:10.1186/bcr1304

Open Data