<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>bcr774</ui>
	<ji>BCJ</ji>
	<fm>
		<dochead>Research article</dochead>
		<bibl>
			<title>
				<p>A screen for germline mutations in the gene encoding CCCTC-binding factor (CTCF) in familial non-<it>BRCA1/BRCA2 </it>breast cancer</p>
			</title>
			<aug>
				<au id="A1">
					<snm>Zhou</snm>
					<fnm>Xiao-Lei</fnm>
					<insr iid="I1"/>
				</au>
				<au id="A2">
					<snm>Werelius</snm>
					<fnm>Barbro</fnm>
					<insr iid="I1"/>
				</au>
				<au id="A3" ca="yes">
					<snm>Lindblom</snm>
					<fnm>Annika</fnm>
					<insr iid="I1"/>
					<email>annika.lindblom@cmm.ki.se</email>
				</au>
			</aug>
			<insg>
				<ins id="I1">
					<p>Department of Molecular Medicine, Karolinska Institutet, Stockholm, Sweden</p>
				</ins>
			</insg>
			<source>Breast Cancer Res</source>
			<issn>1465-5411</issn>
			<pubdate>2004</pubdate>
			<volume>6</volume>
			<issue>3</issue>
			<fpage>R187</fpage>
			<lpage>R190</lpage>
			<url>http://breast-cancer-research.com/content/6/3/R187</url>
			<xrefbib>
				<pubid idtype="pmpid">15084242</pubid>
			</xrefbib>
		</bibl>
		<history>
			<rec>
				<date>
					<day>7</day>
					<month>8</month>
					<year>2003</year>
				</date>
			</rec>
			<revreq>
				<date>
					<day>28</day>
					<month>8</month>
					<year>2003</year>
				</date>
			</revreq>
			<revrec>
				<date>
					<day>4</day>
					<month>2</month>
					<year>2004</year>
				</date>
			</revrec>
			<acc>
				<date>
					<day>12</day>
					<month>2</month>
					<year>2004</year>
				</date>
			</acc>
			<pub>
				<date>
					<day>9</day>
					<month>3</month>
					<year>2004</year>
				</date>
			</pub>
		</history>
		<cpyrt>
			<year>2004</year>
			<collab>Zhou et al., licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
		</cpyrt>
		<kwdg>
			<kwd>CTCF</kwd>
			<kwd>familial breast cancer</kwd>
			<kwd>mutation screening</kwd>
		</kwdg>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st>
						<p>Introduction</p>
					</st>
					<p>The CCCTC-binding factor (CTCF), known as a versatile transcription factor and chromatin insulator and to be involved in X inactivation, has also been suggested to be a tumour suppressor on 16q. We investigated 153 patients with familial non-<it>BRCA1/BRCA2 </it>breast cancer for germline mutations in the <it>CTCF </it>gene.</p>
				</sec>
				<sec>
					<st>
						<p>Methods</p>
					</st>
					<p>Mutation screening of <it>CTCF </it>was performed by denaturing high-performance liquid chromatography followed by cycle sequencing.</p>
				</sec>
				<sec>
					<st>
						<p>Results</p>
					</st>
					<p>We found two sequence variants, <sup>240</sup>G&#8594;A in the 5' untranslated region and <sup>1455</sup>C&#8594;T (S388S) in exon 4, in five familial breast cancer cases. Three of these five cases had both variants. Cases and controls showed the same prevalence for the two variants, which were found in linkage disequilibrium in most cases and controls.</p>
				</sec>
				<sec>
					<st>
						<p>Conclusion</p>
					</st>
					<p>The present study suggests that germline mutations in <it>CTCF </it>are not important as a risk factor for breast cancer.</p>
				</sec>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Introduction</p>
			</st>
			<p>The CCCTC-binding factor (CTCF), best known as a versatile transcription factor and chromatin insulator (reviewed in <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>), has been suggested as a risk factor in familial breast cancer, possibly acting as a tumour suppressor. The gene was mapped to 16q22&#8211;24, a region frequently showing loss of heterozygosity (LOH) in sporadic and familial breast cancer <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>, and LOH of this region has been shown to correlate to increased survival and late distant metastasis <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. A tumour-specific rearrangement of <it>CTCF </it>exons was first reported in one primary breast cancer patient <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, and four additional <it>CTCF </it>somatic mutations were subsequently observed in a set of 130 cases of breast, prostate and Wilms tumours in another study <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>.</p>
			<p>Skewed X inactivation denotes that the choice of which of the two X chromosomes is inactivated in females is non-random <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>; it has been implicated in cancer development. In a study of patients with ovarian cancer, a higher frequency of skewed X inactivation was found in patients with invasive cancer than in patients with borderline cancer and healthy controls <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. It was also found that young patients with breast cancer have a higher frequency of skewed X inactivation in blood cells than controls of the same age <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. This finding indicated that skewed X inactivation might be a risk factor in breast cancer development, and suggested the involvement of as yet unknown X-linked genes, or genetic factors involved in the X inactivation process in the development of breast cancer in young females. Recently, CTCF was shown to be a candidate <it>trans</it>-acting factor for X inactivation choice <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>, suggesting that it might therefore have a role in breast development.</p>
			<p>In the present study we investigated <it>CTCF </it>for germline mutations in 153 cases from 139 non-<it>BRCA1/BRCA2 </it>breast cancer families to determine whether <it>CTCF </it>mutations could have a role in breast cancer predisposition. Of the 139 families, 28 had previously been included in a genome-wide linkage analysis. The linkage analysis results showed that all the 28 families could share a putative predisposing gene in 16q22&#8211;24 (Luo <it>et al</it>., unpublished data). In addition, 26 tumours from 26 of the 139 families included in the present study had previously been analysed for LOH <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Of the 26 tumours analysed, 16 were informative for at least one microsatellite marker at 16q. Only three tumours showed LOH at 16q and were investigated for germline mutations in the E-cadherin gene, and no pathogenic mutation was found <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Thus E-cadherin is not likely to be involved in our breast cancer cases.</p>
		</sec>
		<sec>
			<st>
				<p>Materials and methods</p>
			</st>
			<sec>
				<st>
					<p>Patients</p>
				</st>
				<p>For <it>CTCF </it>analysis, 153 breast cancer patients were recruited from 139 families. In our previous genome-wide linkage analysis, 28 of the families were shown to share a common haplotype in 16q22&#8211;24, where the <it>CTCF </it>gene resides. All the families included were recruited through a clinicogenetic counselling procedure and were considered <it>BRCA1 </it>and <it>BRCA2 </it>negative <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>. In total, 90 cases were ascertained from high-risk families in which there were three or more first-degree affected relatives with breast cancer over at least two generations. The mean number of cases in each family was 3.3 and the mean age of diagnosis was 53 years of age. The other 63 cases were ascertained from low-risk families in which there were only two first-degree affected relatives with breast cancer, with a mean age of onset of 47 years. All the cases in this study were included in accordance with guidelines approved by the Ethics Committee at Karolinska Institutet. As control population we used 190 unrelated healthy relatives of patients recruited at Department of Clinical Genetics, Karolinska Hospital.</p>
			</sec>
			<sec>
				<st>
					<p>Denaturing high-performance liquid chromatography (DHPLC)</p>
				</st>
				<p>DHPLC analysis was performed with automated instrumentation equipped with a DNASep column, the Wave<sup>&#174; </sup>nucleic acid fragment analysis system (Transgenomic, Santa Clara, CA), on the reverse transcriptase polymerase chain reaction (RT&#8211;PCR) product. The entire coding sequence of the gene <it>CTCF </it>was divided into six overlapping fragments; the primers used for RT&#8211;PCR amplification of each segment are given in Table <tblr tid="T1">1</tblr>. Total RNA of each sample was extracted from EBV-transformed lymphocytes using TRIzol<sup>&#174; </sup>Total RNA Isolation Reagent kit (Invitrogen, Carlsbad, CA) and was reverse transcribed with random hexamers using the GeneAmp<sup>&#174; </sup>RNA PCR kit (PE Biosystems, Foster City, CA) to generate cDNA. A 2 &#956;l aliquot of cDNA was used in PCR amplification in 50 &#956;l reaction volumes containing 10 pmol of sense and antisense primers for each fragment, 1.5 mM MgCl<sub>2</sub>, 100 &#956;M dNTPs, 1.25 U of AmpliTaq Gold polymerase (PE Biosystems) and 1 &#215; PCR buffer supplied by the manufacturer. A universal Touchdown PCR protocol was employed to improve PCR specificity and to minimize PCR optimization. It consisted of an initial incubation of 95&#176;C for 10 min, a first round of 6 cycles of 95&#176;C for 30 s, 58&#176;C for 45 s with 1&#176;C decrement per cycle, 72&#176;C for 45 s, a second round of 26 cycles of 95&#176;C for 30 s, 53&#176;C for 45 s, 72&#176;C for 45 s, and a final extension step of 72&#176;C for 7 min. PCR products were then denatured at 95&#176;C for 5 min and cooled slowly in a PCR instrument at a rate of 1.5&#176;C per cycle for 40 cycles. Each PCR product (10 &#956;l) was then loaded on the Wave<sup>&#174; </sup>instrument and eluted with a linear acetonitrile gradient consisting of buffer A (0.1 M triethylamine acetate; TEAA) and buffer B (0.1 M TEAA in 25% acetonitrile) at a constant flow rate of 0.9 ml/min. Specific values of the gradient ranges and the column temperature required for optimal resolution of each amplicon were determined by the WaveMaker software (Transgenomic) based on the sequence. A Mutation Standard (Transgenomic) was run with the samples analysed, to ensure the best performance of the DHPLC instrument for mutation detection. The elution profiles were recorded and analysed by HSM 7000 software (Transgenomic).</p>
				<tbl id="T1">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>List of the primers used for amplification and cycle sequencing in the polymerase chain reaction</p>
					</caption>
					<tblbdy cols="4">
						<r>
							<c ca="left">
								<p>Fragments</p>
							</c>
							<c ca="left">
								<p>Sense (5'&#8211;3') positions of primers<sup>a</sup></p>
							</c>
							<c ca="left">
								<p>Antisense (5'&#8211;3') positions of primers</p>
							</c>
							<c ca="center">
								<p>Size (bp)</p>
							</c>
						</r>
						<r>
							<c cspan="4">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p><sup>162</sup>GGAGAATGATTACGGACCTG<sup>181</sup></p>
							</c>
							<c ca="left">
								<p><sup>622</sup>CTATGTTTATGGGCTGTTCCTC<sup>601</sup></p>
							</c>
							<c ca="center">
								<p>461</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>2</p>
							</c>
							<c ca="left">
								<p><sup>519</sup>AGTAATGGAGGGCACAGTG<sup>537</sup></p>
							</c>
							<c ca="left">
								<p><sup>1017</sup>CGCATTAACCTCTGATAGCA<sup>998</sup></p>
							</c>
							<c ca="center">
								<p>499</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>3</p>
							</c>
							<c ca="left">
								<p><sup>940</sup>GAGGGCAAAGATGTAGATGTG<sup>960</sup></p>
							</c>
							<c ca="left">
								<p><sup>1415</sup>CCAGTATGAGAGCGAATGTGA<sup>1395</sup></p>
							</c>
							<c ca="center">
								<p>476</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p><sup>1366</sup>GCCAGTGTAGAAGTCAGCAA<sup>1385</sup></p>
							</c>
							<c ca="left">
								<p><sup>1811</sup>TCCTGTCTACAAGCGTAATCA<sup>1791</sup></p>
							</c>
							<c ca="center">
								<p>446</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>5</p>
							</c>
							<c ca="left">
								<p><sup>1768</sup>AAGCGCTTTAAGTGTGACCAG<sup>1788</sup></p>
							</c>
							<c ca="left">
								<p><sup>2184</sup>TTCTACGGCAGGCTCCTC<sup>2167</sup></p>
							</c>
							<c ca="center">
								<p>417</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6</p>
							</c>
							<c ca="left">
								<p><sup>2044</sup>GGGGAAAAGGAGGAGAA<sup>2061</sup></p>
							</c>
							<c ca="left">
								<p><sup>2520</sup>TAAACACAGCCCAGAGAAGTC<sup>2500</sup></p>
							</c>
							<c ca="center">
								<p>477</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p><sup>a</sup>Position according to GenBank reference cDNA sequence NM_006565. bp, base pairs.</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Cycle sequencing</p>
				</st>
				<p>Samples with an altered DHPLC profiles were reamplified and purified with QIAEX II gel extraction kit (Qiagen, Hilden, Germany). The bi-directional sequencing reaction was performed with ABI PRISM<sup>&#174; </sup>BigDye&#8482; Terminator Cycle Sequencing Ready Reaction Kits version 2.0 (PE Biosystems) in accordance with the manufacturer's instructions, with the primers used in RT&#8211;PCR amplification as sequencing primers (Table <tblr tid="T1">1</tblr>).</p>
			</sec>
			<sec>
				<st>
					<p>Pyrosequencing</p>
				</st>
				<p>Pyrosequencing was adopted in this study to determine the frequency of the <it>CTCF </it>variants found in familial breast cancer cases in normal controls. Primers used in the pyrosequencing analysis are listed in Table <tblr tid="T2">2</tblr>. The conditions of PCR amplification were the same as those used in the DHPLC analysis except that genomic DNA rather than cDNA was used as template and the number of cycles was increased from 35 to 50. Biotin-labelled amplicons (30 &#956;l) were mixed with 25 &#956;l of BW buffer (10 mM Tris-HCl, 2 M NaCl, 1 mM EDTA and 0.1 Tween 20, pH 7.6) and immobilized on 20 &#956;l of streptavidin-coated super paramagnetic beads (Dynabeads<sup>&#174;</sup>, M-280&#8211;streptavidin; Dynal AS, Oslo, Norway) by incubation at 65&#176;C for 15 min, with shaking. Single-stranded DNA was obtained by incubating the immobilized amplicons in 50 &#956;l of 0.5 M NaOH for 5 min using a PSQ 96 Sample Prep Tool (Pyrosequencing AB, Uppsala, Sweden). Each sample (well) was washed twice with 100 &#956;l of 1 &#215; annealing buffer (200 mM Tris acetate and 50 mM magnesium acetate). The immobilized strand was resuspended in 45 &#956;l of 1 &#215; annealing buffer containing 2 pmol of sequencing primer. Hybridization was performed by incubation at 80&#176;C for 2 min, followed by cooling to room temperature. Finally, real-time pyrosequencing was performed on an automated 96-well pyrosequencer instrument with a PSQ SNP Reagent Kit (including all required enzymes and substrates) provided by the manufacturer (Pyrosequencing AB). The base sequence interpretation of the chromatograms and SNP genotype recognition were implemented automatically by the software and checked manually.</p>
				<tbl id="T2">
					<title>
						<p>Table 2</p>
					</title>
					<caption>
						<p>List of the primers used for pyrosequencing</p>
					</caption>
					<tblbdy cols="4">
						<r>
							<c ca="left">
								<p>Exons</p>
							</c>
							<c ca="left">
								<p>Sense (5'&#8211;3') positions of primers<sup>a</sup></p>
							</c>
							<c ca="left">
								<p>Antisense (5'&#8211;3') positions of primers<sup>b</sup></p>
							</c>
							<c ca="left">
								<p>Sequencing positions of primers</p>
							</c>
						</r>
						<r>
							<c cspan="4">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>5' UTR</p>
							</c>
							<c ca="left">
								<p><sup>188</sup>AAGAACAAGATGCGCTAG<sup>205</sup></p>
							</c>
							<c ca="left">
								<p>Biotin-<sup>259</sup>CTCCGTGGCTGCAAAGTCAGTT<sup>280</sup></p>
							</c>
							<c ca="left">
								<p><sup>216</sup>GCTGACCAGGGGCTTGAGAGCTGGG<sup>239</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p><sup>723</sup>TCACATTCGCTCTCATACTGG<sup>742</sup></p>
							</c>
							<c ca="left">
								<p>Biotin-<sup>968</sup>CGGAGAAGCATTATCAATTC<sup>949</sup></p>
							</c>
							<c ca="left">
								<p><sup>758</sup>AGTGCAGTTTGTGCAGTTATGC<sup>779</sup></p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p><sup>a</sup>Position according to GenBank reference cDNA sequence NM_006565. <sup>b</sup>Position according to GenBank reference DNA sequence AF145470. UTR, untranslated region.</p>
					</tblfn>
				</tbl>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Results and discussion</p>
			</st>
			<p>In 153 familial non-<it>BRCA1/BRCA2 </it>breast cancer cases, we found two sequence variants, <sup>240</sup>G&#8594;A in the 5' untranslated region and <sup>1455</sup>C&#8594;T (S388S) in exon 4. Each variant was identified in four cases (4 of 153; 2.6%). The method used for studying this gene was selected to minimize the risk of missing a mutation for technical reasons. The DHPLC technique is known to be very sensitive; the fragment length and optimal conditions for the DHPLC assay were carefully designed and the RNA template used was expressed in sufficient amounts. Thus, the low mutation frequency obtained in the present study is not due to the methods used.</p>
			<p>The <sup>240</sup>G&#8594;A alteration was identified in 12 of 186 normal controls (6.5%), and the <sup>1455</sup>C&#8594;T alteration in 10 of 188 normal controls (5.3%). Each variant had similar prevalences in controls and in familial breast cancer cases (<it>P </it>= 0.10 and <it>P </it>= 0.21, respectively; &#967;<sup>2 </sup>test).</p>
			<p>In addition, both variants were found to occur together in three of the cases. They might be in linkage disequilibrium and constitute a haplotype on the same chromosome. Alternatively, they might be on two different chromosomes. If so, they could each contribute a causative effect, acting in a recessive mode, and the concurrence of the two variants should be observed more often in familial cases than in normal controls as a result of genetic selection. On examining the normal controls, 10 of the 12 individuals with sequence alteration turned out to be carriers of both the variants, which was similar to the familial cases. Thus, these two variants were most probably inherited together on the same chromosome &#8211; that is, in linkage disequilibrium &#8211; in most breast cancer cases and controls. The concurrence of the two variants is not caused by genetic selection, and accordingly both the variants are considered non-pathogenic.</p>
		</sec>
		<sec>
			<st>
				<p>Conclusion</p>
			</st>
			<p>The present study suggests that germline mutations in the <it>CTCF </it>gene are not important as a risk factor in familial breast cancer. However, the <it>CTCF </it>gene could still have a role in cancer development. A tumour-specific truncating 14 base pair insertion in the <it>CTCF </it>gene was recently identified in one invasive ductal breast cancer case. The mutation resulted in silencing of the wild-type allele and loss of protein expression <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. Moreover, CTCF is likely to participate in loss of imprinting of the gene encoding insulin-like growth factor II (IGF2) in colorectal cancer and Wilms tumours <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. Further studies are therefore needed to elucidate the role of <it>CTCF </it>in breast cancer.</p>
		</sec>
		<sec>
			<st>
				<p>Competing interests</p>
			</st>
			<p>None declared.</p>
		</sec>
		<sec>
			<st>
				<p>Abbreviations</p>
			</st>
			<p>CTCF = CCCTC-binding factor; DHPLC = denaturing high-performance liquid chromatography; LOH = loss of heterozygosity; RT&#8211;PCR = reverse transcriptase&#8211;polymerase chain reaction.</p>
		</sec>
	</bdy>
	<bm>
		<ack>
			<sec>
				<st>
					<p>Acknowledgements</p>
				</st>
				<p>We thank the families for their cooperation, and Victor Lobanenkov for valuable discussions. The study was financed by the Swedish Cancer Society, the Stockholm Cancer Society and the Gustav V Jubilee Foundation.</p>
			</sec>
		</ack>
		<refgrp>
			<bibl id="B1">
				<title>
					<p>CTCF is a uniquely versatile transcription regulator linked to epigenetics and disease</p>
				</title>
				<aug>
					<au>
						<snm>Ohlsson</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Renkawitz</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Lobanenkov</snm>
						<fnm>V</fnm>
					</au>
				</aug>
				<source>Trends Genet</source>
				<pubdate>2001</pubdate>
				<volume>17</volume>
				<fpage>520</fpage>
				<lpage>527</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0168-9525(01)02366-6</pubid>
						<pubid idtype="pmpid" link="fulltext">11525835</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B2">
				<title>
					<p>At least two different regions are involved in allelic imbalance on chromosome arm 16q in breast cancer</p>
				</title>
				<aug>
					<au>
						<snm>Cleton-Jansen</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>Moerland</snm>
						<fnm>EW</fnm>
					</au>
					<au>
						<snm>Kuipers-Dijkshoorn</snm>
						<fnm>NJ</fnm>
					</au>
					<au>
						<snm>Callen</snm>
						<fnm>DF</fnm>
					</au>
					<au>
						<snm>Sutherland</snm>
						<fnm>GR</fnm>
					</au>
					<au>
						<snm>Hansen</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Devilee</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Cornelisse</snm>
						<fnm>CJ</fnm>
					</au>
				</aug>
				<source>Genes Chromosomes Cancer</source>
				<pubdate>1994</pubdate>
				<volume>9</volume>
				<fpage>101</fpage>
				<lpage>107</lpage>
				<xrefbib>
					<pubid idtype="pmpid">7513539</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B3">
				<title>
					<p>Allelic imbalance study of 16q in human primary breast carcinomas using microsatellite markers</p>
				</title>
				<aug>
					<au>
						<snm>Dorion-Bonnet</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Mautalen</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Hostein</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Longy</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Genes Chromosomes Cancer</source>
				<pubdate>1995</pubdate>
				<volume>14</volume>
				<fpage>171</fpage>
				<lpage>181</lpage>
				<xrefbib>
					<pubid idtype="pmpid">8589033</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B4">
				<title>
					<p>Deletions on chromosome 16 in primary familial breast carcinomas are associated with development of distant metastases</p>
				</title>
				<aug>
					<au>
						<snm>Lindblom</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Rotstein</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Skoog</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Nordenskjold</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Larsson</snm>
						<fnm>C</fnm>
					</au>
				</aug>
				<source>Cancer Res</source>
				<pubdate>1993</pubdate>
				<volume>53</volume>
				<fpage>3707</fpage>
				<lpage>3711</lpage>
				<xrefbib>
					<pubid idtype="pmpid">8339280</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B5">
				<title>
					<p>A region on the long arm of chromosome 16 is frequently deleted in metastatic node-negative breast cancer</p>
				</title>
				<aug>
					<au>
						<snm>Caligo</snm>
						<fnm>MA</fnm>
					</au>
					<au>
						<snm>Polidoro</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Ghimenti</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Campani</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Cecchetti</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Bevilacqua</snm>
						<fnm>G</fnm>
					</au>
				</aug>
				<source>Int J Oncol</source>
				<pubdate>1998</pubdate>
				<volume>13</volume>
				<fpage>177</fpage>
				<lpage>182</lpage>
				<xrefbib>
					<pubid idtype="pmpid">9625819</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B6">
				<title>
					<p>Allelic loss of 16q23.2&#8211;24.2 is an independent marker of good prognosis in primary breast cancer</p>
				</title>
				<aug>
					<au>
						<snm>Hansen</snm>
						<fnm>LL</fnm>
					</au>
					<au>
						<snm>Yilmaz</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Overgaard</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Andersen</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Kruse</snm>
						<fnm>TA</fnm>
					</au>
				</aug>
				<source>Cancer Res</source>
				<pubdate>1998</pubdate>
				<volume>58</volume>
				<fpage>2166</fpage>
				<lpage>2169</lpage>
				<xrefbib>
					<pubid idtype="pmpid">9605761</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B7">
				<title>
					<p>A widely expressed transcription factor with multiple DNA sequence specificity, CTCF, is localized at chromosome segment 16q22.1 within one of the smallest regions of overlap for common deletions in breast and prostate cancers</p>
				</title>
				<aug>
					<au>
						<snm>Filippova</snm>
						<fnm>GN</fnm>
					</au>
					<au>
						<snm>Lindblom</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Meincke</snm>
						<fnm>LJ</fnm>
					</au>
					<au>
						<snm>Klenova</snm>
						<fnm>EM</fnm>
					</au>
					<au>
						<snm>Neiman</snm>
						<fnm>PE</fnm>
					</au>
					<au>
						<snm>Collins</snm>
						<fnm>SJ</fnm>
					</au>
					<au>
						<snm>Doggett</snm>
						<fnm>NA</fnm>
					</au>
					<au>
						<snm>Lobanenkov</snm>
						<fnm>VV</fnm>
					</au>
				</aug>
				<source>Genes Chromosomes Cancer</source>
				<pubdate>1998</pubdate>
				<volume>22</volume>
				<fpage>26</fpage>
				<lpage>36</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/(SICI)1098-2264(199805)22:1&lt;26::AID-GCC4&gt;3.3.CO;2-W</pubid>
						<pubid idtype="pmpid" link="fulltext">9591631</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B8">
				<title>
					<p>Tumor-associated zinc finger mutations in the CTCF transcription factor selectively alter tts DNA-binding specificity</p>
				</title>
				<aug>
					<au>
						<snm>Filippova</snm>
						<fnm>GN</fnm>
					</au>
					<au>
						<snm>Qi</snm>
						<fnm>CF</fnm>
					</au>
					<au>
						<snm>Ulmer</snm>
						<fnm>JE</fnm>
					</au>
					<au>
						<snm>Moore</snm>
						<fnm>JM</fnm>
					</au>
					<au>
						<snm>Ward</snm>
						<fnm>MD</fnm>
					</au>
					<au>
						<snm>Hu</snm>
						<fnm>YJ</fnm>
					</au>
					<au>
						<snm>Loukinov</snm>
						<fnm>DI</fnm>
					</au>
					<au>
						<snm>Pugacheva</snm>
						<fnm>EM</fnm>
					</au>
					<au>
						<snm>Klenova</snm>
						<fnm>EM</fnm>
					</au>
					<au>
						<snm>Grundy</snm>
						<fnm>PE</fnm>
					</au>
					<etal/>
				</aug>
				<source>Cancer Res</source>
				<pubdate>2002</pubdate>
				<volume>62</volume>
				<fpage>48</fpage>
				<lpage>52</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">11782357</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B9">
				<title>
					<p>Skewed X inactivation in X-linked disorders</p>
				</title>
				<aug>
					<au>
						<snm>Van den Veyver</snm>
						<fnm>IB</fnm>
					</au>
				</aug>
				<source>Semin Reprod Med</source>
				<pubdate>2001</pubdate>
				<volume>19</volume>
				<fpage>183</fpage>
				<lpage>191</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1055/s-2001-15398</pubid>
						<pubid idtype="pmpid">11480916</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B10">
				<title>
					<p>Association between nonrandom X-chromosome inactivation and BRCA1 mutation in germline DNA of patients with ovarian cancer</p>
				</title>
				<aug>
					<au>
						<snm>Buller</snm>
						<fnm>RE</fnm>
					</au>
					<au>
						<snm>Sood</snm>
						<fnm>AK</fnm>
					</au>
					<au>
						<snm>Lallas</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Buekers</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Skilling</snm>
						<fnm>JS</fnm>
					</au>
				</aug>
				<source>J Natl Cancer Inst</source>
				<pubdate>1999</pubdate>
				<volume>91</volume>
				<fpage>339</fpage>
				<lpage>346</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1093/jnci/91.4.339</pubid>
						<pubid idtype="pmpid" link="fulltext">10050867</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B11">
				<title>
					<p>High frequency of skewed X inactivation in young breast cancer patients</p>
				</title>
				<aug>
					<au>
						<snm>Kristiansen</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Langerod</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Knudsen</snm>
						<fnm>GP</fnm>
					</au>
					<au>
						<snm>Weber</snm>
						<fnm>BL</fnm>
					</au>
					<au>
						<snm>Borresen-Dale</snm>
						<fnm>AL</fnm>
					</au>
					<au>
						<snm>Orstavik</snm>
						<fnm>KH</fnm>
					</au>
				</aug>
				<source>J Med Genet</source>
				<pubdate>2002</pubdate>
				<volume>39</volume>
				<fpage>30</fpage>
				<lpage>33</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1136/jmg.39.1.30</pubid>
						<pubid idtype="pmpid" link="fulltext">11826021</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B12">
				<title>
					<p>CTCF, a candidate <it>trans</it>-acting factor for X-inactivation choice</p>
				</title>
				<aug>
					<au>
						<snm>Chao</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Huynh</snm>
						<fnm>KD</fnm>
					</au>
					<au>
						<snm>Spencer</snm>
						<fnm>RJ</fnm>
					</au>
					<au>
						<snm>Davidow</snm>
						<fnm>LS</fnm>
					</au>
					<au>
						<snm>Lee</snm>
						<fnm>JT</fnm>
					</au>
				</aug>
				<source>Science</source>
				<pubdate>2002</pubdate>
				<volume>295</volume>
				<fpage>345</fpage>
				<lpage>347</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1126/science.1065982</pubid>
						<pubid idtype="pmpid" link="fulltext">11743158</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B13">
				<title>
					<p>Loss of heterozygosity in familial breast carcinomas</p>
				</title>
				<aug>
					<au>
						<snm>Lindblom</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Skoog</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Rotstein</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Werelius</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Larsson</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Nordenskjold</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Cancer Res</source>
				<pubdate>1993</pubdate>
				<volume>53</volume>
				<fpage>4356</fpage>
				<lpage>4361</lpage>
				<xrefbib>
					<pubid idtype="pmpid">8364930</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B14">
				<title>
					<p>Low frequency of E-cadherin alterations in familial breast cancer</p>
				</title>
				<aug>
					<au>
						<snm>Salahshor</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Haixin</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Huo</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Kristensen</snm>
						<fnm>VN</fnm>
					</au>
					<au>
						<snm>Loman</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Sjoberg-Margolin</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Borg</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Borresen-Dale</snm>
						<fnm>AL</fnm>
					</au>
					<au>
						<snm>Vorechovsky</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Lindblom</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Breast Cancer Res</source>
				<pubdate>2001</pubdate>
				<volume>3</volume>
				<fpage>199</fpage>
				<lpage>207</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1186/bcr295</pubid>
						<pubid idtype="pmpid" link="fulltext">11305955</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B15">
				<title>
					<p>First BRCA1 and BRCA2 gene testing implemented in the health care system of Stockholm</p>
				</title>
				<aug>
					<au>
						<snm>Arver</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Borg</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Lindblom</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Genet Test</source>
				<pubdate>2001</pubdate>
				<volume>5</volume>
				<fpage>1</fpage>
				<lpage>8</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1089/109065701750168581</pubid>
						<pubid idtype="pmpid" link="fulltext">11336395</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B16">
				<title>
					<p>BRCA2 germline mutations in Swedish breast cancer families</p>
				</title>
				<aug>
					<au>
						<snm>Chen</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Hedman</snm>
						<fnm>MZ</fnm>
					</au>
					<au>
						<snm>Arver</snm>
						<fnm>BW</fnm>
					</au>
					<au>
						<snm>Sigurdsson</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Eyfjord</snm>
						<fnm>JE</fnm>
					</au>
					<au>
						<snm>Lindblom</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Eur J Hum Genet</source>
				<pubdate>1998</pubdate>
				<volume>6</volume>
				<fpage>134</fpage>
				<lpage>139</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/sj.ejhg.5200167</pubid>
						<pubid idtype="pmpid" link="fulltext">9781057</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B17">
				<title>
					<p>CTCF gene mutations in invasive ductal breast cancer</p>
				</title>
				<aug>
					<au>
						<snm>Aulmann</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Blaker</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Penzel</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Rieker</snm>
						<fnm>RJ</fnm>
					</au>
					<au>
						<snm>Otto</snm>
						<fnm>HF</fnm>
					</au>
					<au>
						<snm>Sinn</snm>
						<fnm>HP</fnm>
					</au>
				</aug>
				<source>Breast Cancer Res Treat</source>
				<pubdate>2003</pubdate>
				<volume>80</volume>
				<fpage>347</fpage>
				<lpage>352</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1023/A:1024930404629</pubid>
						<pubid idtype="pmpid" link="fulltext">14503807</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B18">
				<title>
					<p>Loss of imprinting of insulin-like growth factor-II in Wilms' tumor commonly involves altered methylation but not mutations of CTCF or its binding site</p>
				</title>
				<aug>
					<au>
						<snm>Cui</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Niemitz</snm>
						<fnm>EL</fnm>
					</au>
					<au>
						<snm>Ravenel</snm>
						<fnm>JD</fnm>
					</au>
					<au>
						<snm>Onyango</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Brandenburg</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Lobanenkov</snm>
						<fnm>VV</fnm>
					</au>
					<au>
						<snm>Feinberg</snm>
						<fnm>AP</fnm>
					</au>
				</aug>
				<source>Cancer Res</source>
				<pubdate>2001</pubdate>
				<volume>61</volume>
				<fpage>4947</fpage>
				<lpage>4950</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">11431321</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B19">
				<title>
					<p>Loss of imprinting of the insulin-like growth factor II gene occurs by biallelic methylation in a core region of H19-associated CTCF-binding sites in colorectal cancer</p>
				</title>
				<aug>
					<au>
						<snm>Nakagawa</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Chadwick</snm>
						<fnm>RB</fnm>
					</au>
					<au>
						<snm>Peltomaki</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Plass</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Nakamura</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>de La Chapelle</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>2001</pubdate>
				<volume>98</volume>
				<fpage>591</fpage>
				<lpage>596</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1073/pnas.011528698</pubid>
						<pubid idtype="pmpid" link="fulltext">11120891</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
		</refgrp>
	</bm>
</art>

